|
GenScript corporation
sirna target finder Sirna Target Finder, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+finder/sirna+target+finder/pmc12274417-46-23-26 Average 90 stars, based on 1 article reviews
sirna target finder - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
MolBio Diagnostics
crispr optimal target finder tool Crispr Optimal Target Finder Tool, supplied by MolBio Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+finder/crispr+optimal+target+finder/pm40553497-261-8-18 Average 90 stars, based on 1 article reviews
crispr optimal target finder tool - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
sirna-target-finder Sirna Target Finder, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+finder/sirna+target+finder/pmc12120405-86-12-13 Average 90 stars, based on 1 article reviews
sirna-target-finder - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
MolBio Diagnostics
flycrispr target finder Flycrispr Target Finder, supplied by MolBio Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+finder/crispr+optimal+target+finder/bio_rxiv__2025__04__24__650404-255-36-39 Average 90 stars, based on 1 article reviews
flycrispr target finder - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
sirna target finder tool Sirna Target Finder Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+finder/sirna+target+finder/pmc12010883-45-9-13 Average 90 stars, based on 1 article reviews
sirna target finder tool - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
MolBio Diagnostics
crispr optimal target finder Crispr Optimal Target Finder, supplied by MolBio Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+finder/crispr+optimal+target+finder/10__1091_slash_mbc__e25___01___0021-333-10-14 Average 90 stars, based on 1 article reviews
crispr optimal target finder - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
|
Addgene inc
crispr optimal target finder grna1 agctcggcaacgatggcatt grna2 catgcaggtgttacgccaaa grna3 aaaaaaaaaacgctcttgag grna4 cctgccctcaattaaagtag Crispr Optimal Target Finder Grna1 Agctcggcaacgatggcatt Grna2 Catgcaggtgttacgccaaa Grna3 Aaaaaaaaaacgctcttgag Grna4 Cctgccctcaattaaagtag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+finder/gRNAs%5BbTub%2BSxl%5D%2E1046B+(Plasmid+%23112692)/bio_rxiv__2025__02__03__636302-279-12-34 Average 94 stars, based on 1 article reviews
crispr optimal target finder grna1 agctcggcaacgatggcatt grna2 catgcaggtgttacgccaaa grna3 aaaaaaaaaacgctcttgag grna4 cctgccctcaattaaagtag - by Bioz Stars,
2026-11
94/100 stars
|
Buy from Supplier |